Учёные из Гарварда записали 643 килобайта данных в молекулу ДНК



    Молекулы ДНК — это идеальный носитель информации: они фантастически компактны, стабильны, энергетически эффективны и надёжны: доказанная продолжительность хранения информации в ДНК составляет 3,5 миллиарда лет. Четыре грамма молекул ДНК, теоретически, могут вместить всю информацию, созданную человечеством за год.

    Неудивительно, что учёные упорно пытаются найти удобный способ записи и считывания информации из ДНК. Два года назад биологи из Гонконга сумели внедрить в клетку бактерии E.coli синтетическую ДНК с несколькими килобайтами зашифрованной информации. В одном грамме бактерий около 10 млн клеток, а информационная плотность такого хранилища можно оценить в 900 ТБ на 1 грамм бактерий.

    Сейчас специалисты из Кембриджского университета под руководством Джорджа Чёрча (George Church) бросили вызов китайским коллегам и поставили новый рекорд по количеству информации, внедрённой в синтетическую ДНК. Они смогли записать текст целой книги в 1 пикограмм молекул (пикограмм — одна триллионная грамма). Научная работа опубликована 16 августа 2012 года в журнале Science.

    Для кодирования информации в ДНК используется четверичная система счисления, по количеству нуклеотидов (0 = A, 1 = T, 2 = C, 3 = G). Специалисты из Китайского университета Гонконга переводили текст в цифры по таблице ASCII (i = 105; G = 71; E = 69; M = 77), затем в четверичную систему (105 → 1221; 71 → 0113; 69 → 0111; 77 → 0131), а потом в цепочку нуклеотидов.

    iGem → 1221011301110131 → ATCTATTGATTTATGT

    Специалисты из Гарварда использовали другой метод. Во-первых, они принципиально отказались от использования живых организмов, а внедряли синтетическую ДНК в молекулу, сгенерированную на коммерческом ДНК-чипе. Таким образом, записанная информация не может быть потеряна из-за генетических мутаций при эволюции организма-носителя.

    Во-вторых, они кодировали не текст ASCII, а бинарный код — последнюю книгу Чёрча, с сохранением форматирования HTML и иллюстраций JPEG. Перед записью код разбили на 96-битные блоки. Общий объём записанной информации составил 54898 таких блоков, то есть примерно 643 килобайта, включая служебную информацию — 19-битный уникальный адрес каждого блока (на диаграмме внизу он изображён красным цветом).



    В данном эксперименте достигнута информационная плотность записи 5,5 петабит на кубический миллиметр. Такой показатель плотности информации можно сравнить с передовыми разработками в области квантовой голографии, но если там требуется создание экстремально низких температур, то молекулы ДНК отлично себя чувствуют при комнатной температуре. «Вы можете бросить их где хотите, в пустыне или у себя во дворе, и они будут там через 400 тысяч лет», — говорит профессор Чёрч.

    Запись и считывание информации, то есть синтез и секвенирование ДНК, конечно, происходит гораздо медленнее, чем запись и считывание магнитных или оптических накопителей. Поэтому биологические молекулы больше приспособлены для долговременного хранения больших объёмов данных, а не для частого считывания.



    via Science, ExtremeTech, Harvard Medical School, Хабрахабр
    Поделиться публикацией
    Ой, у вас баннер убежал!

    Ну. И что?
    Реклама
    Комментарии 114
    • +4
      Бесконечная магнитная лента?

      Если можно записывать информацию в ДНК бактерий, что мешает создавать таким образом новые биологические виды или вызывать нужные мутации у уже существующих?

      Даешь рефакторинг ДНК человека?
      • +8
        Одно дело — сконструировать ДНК по конструктивному подобию, а другое — абсолютно точно понять, как это всё работает.
        Опыты на животных не останавливаются ни на минуту. Но пока что прогресс не очень впечатляющий, хотя задел на будущее уже сделан огромный.
        • +1
          … И создал он их по образу и подобию своему, создал их.
          • +3
            Не очень впечатляющий ?) Почитайте о спортивной генетике. Да и генетечиеский анализ до рождения — штука весьма продвинутая.
            • +2
              Тут надо напомнить о темпах снижения стоимости и увеличения производительности секвенирования — закон Мура отдыхает:). А количество рано или поздно перейдет в качество — сейчас люди еще не совсем поняли, что вообще делать с таким обилием данных:). Отсюда и целая новая отрасль ИТ — Big Data.
          • +9
            Незнание того как изменение информации в ДНК скажется на организме. Грубо говоря, создание новых биологических видов или вызов нужных мутаций сейчас можно осуществлять только методом научного тыка. «Давай вот этот ген изменим! Упс, не надо нам третьей ноги. Может давай вот этот? Помо...».
            • +9
              А почему не надо третьей ноги?
              • +12
                Оверинженеринг, особенно учитывая наличие двух рук. Ну и классическое «пока твой конь четырьмя ногами: раз, два, три, четыре, мальчишка на двух ногах: раз-два, раз-два» :)
                • +9
                  А почему не надо третьей ноги?
                  Будет сильно мешать во время полового акта.
                  • +3
                    Не надо нам никакого полового акта. Мы умеем ДНК изменять!
                  • НЛО прилетело и опубликовало эту надпись здесь
                • НЛО прилетело и опубликовало эту надпись здесь
                  • +1
                    Утрировал, конечно. Но насколько я знаю до генерации даже простейших организмов «согласно ТЗ» ещё очень далеко, да даже до предсказания по имеющейся ДНК какой организм получится. Какие-то частные случаи, вероятно, известны и ДНК млекопитающего от ДНК гриба отличить могут, но слишком много «глобальных переменных» в программе.
                    • НЛО прилетело и опубликовало эту надпись здесь
                • НЛО прилетело и опубликовало эту надпись здесь
                  • +20
                    Исторически опаснее не сам Создатель, а его адвокаты и прочие доверенные лица.
                    • +2
                      Ну, как сказать… Если вспомнить потоп, то там хоть действие и было разовым, зато масштабы — планетарными.
                      • +1
                        есть мнение, что действие было не разовым и потоп мог быть вызван рядом причин,
                        Например, есть гипотеза о прорвавшемся из-за прилёта гигантского метеорита (Чёрный камень aka хаджар аль-асвад?) или «отнятой» у марса луны (пруфлинк сходу не нашёл но теория в своё время обсуждалась. Суть сводилась к тому, что обычно пропорции «Небесное тело»:«спутник» выражены в 9:1, но к Земле с Луной такое не применимо. В то время, как к Марсу с Луной — вполне. При этом, подобная «штука» могла вызвать катаклизмы и на Марсе и на Земле) «водном» слое (из-за чего, как раз люди стали меньше жить, если следовать описываемым в библии событиям).

                        Либо менее связанное с библией:
                        почти все мифологические отсылки к всемирному потопу и его аналогам указывают на 8-10 тыс. лет до н.э. Приблизительно в это время сошли последние следы другой катастрофы (предположительно вызванной всё тем же падением метеорита) — «ледникового периода» (а именно, речь идёт о Лаурентидском ледниковом щите в Северной Америке), что вызвало очень сильный подъём уровня мирового океана (например, подъём уровня чёрного моря — по некоторым данным, до 140 метров).
                        В своё время мне где-то попадалась на глаза даже визуализация этой теории, отталкивающаяся правда, от того, что там сначала скопилось гигантское море, удерживаемое стеной льда, а потом лёд дал трещину. Далее дело оставалось за цепной реакцией.

                        Собственно, все три теории (две ветки первой и вторая) достаточно «красивы» с точки зрения визуализации и наблюдения «извне», достаточно научны (с некоторыми допущениями, естественно. Хотя к последней теории склоняются как к наиболее вероятной).
                        А вы всё «Создатель», да «Создатель» :)
                  • +4
                    «или вызывать нужные мутации у уже существующих?»
                    Работают уже в этом поле. Новейшие генетически модифицированные продукты, например.
                    Были эксперименты по восстановлению зрения, потерянного из-за наследственного заболевания, вполне успешные, и ещё много чего.
                    • +6
                      Мешает сцепленность генов. Меняшь ген одного признака — непредсказуемо меняется еще несколько сотен\тысяч.
                      • +6
                        Глобальные переменные и высокая связанность — зло для рефакторинга в любой программе, даже биологической :) Зато, зачастую, позволяет решать задачу меньшими ресурсами.
                        • +6
                          С точки зрения программиста человек вообще идиотски сделан :)
                          • +3
                            «Что за идиот этот код писал?! Проще с нуля всё переписать, чем эту фичу здесь сделать!»
                            • +5
                              Когда-нибудь так и будет, уверен. От трансгуманизма нам никуда не деться.
                              • +4
                                Неписи добрались до собственного кода…
                              • +3
                                Меня эти такие высказывания очень забавляют. Чуть выше упоминается, что учёные не могут толком вмешиваться в ДНК, т.к. настоящего понимания что, как и почему происходит нет. При этом, кто-то уже судит о качестве кода.

                                Это всё равно, что получить несколько разрозненных фрагментов некоего кода, на не до конца понятном языке программирования, и по далеко неполному пониманию этих фрагментов делать выводы о том, что всё сделано «идиотски».

                                Просто… Вы не задумывались, что ДНК — это не исходник, а скомпилированный код? А компиляторы порой выдают такую ересь в плане простоты или удобства понимания, что диву даёшься. Но зато они очень хорошо делают свою работу и выполняют свои задачи. А задачи там отнюдь не в том, чтобы скомпилированный код был «красивым» или «грамотно написанным».
                                • +1
                                  С точки зрения живого читателя и бинарники выглядят полной ахинеей, если не использовать специальные инструменты. А ДНК это и исходник тоже, т.к. на основе её «компилируются» новые организмы.
                                  • 0
                                    Эмм… Есть разница, между исходником, и, например, байткодом. Это и не исполняемый код, и не исходник. И компилировать на его основе что-то новое тоже можно.
                                    • +1
                                      По-моему, мы пытаемся искать аналогии, которых нет — человек не программа.
                                      • +1
                                        на самом деле, человек — частный случай биоробота, например.
                                      • НЛО прилетело и опубликовало эту надпись здесь
                                        • 0
                                          Согласен. Но много ли вы видели софта объёмом в сотни мегабайт, написанного на низкоуровневом языке?
                                          • НЛО прилетело и опубликовало эту надпись здесь
                                    • НЛО прилетело и опубликовало эту надпись здесь
                                      • –1
                                        См. выше. Для примера можно взять тот же LLVM. Компилирует он в машинные инструкции (или во что там ещё он умеет компилировать), а оперирует байткодом. Но байткод — это совсем не исходник.

                                        А что касается «вывернутых наизнанку» зрительных рецепторов, то ведь оно ж работает, причём весьма отлично. И не факт, что работало бы так же отлично не будь «вывернуто наизнанку». Просто есть вероятность, что со временем будет обнаружено, почему оно эффективнее (надёжнее, безопаснее, нужное подчеркнуть) другого варианта. Ну, например, вот тут пишут, что если бы светочувствительные волоски не были развёрнутыми, их бы могло повредить даже просто интенсивным дневным светом, особенно, если речь идёт о какой-то вспышке (зайчик), так что радужная оболочка не успеет среагировать.
                                        • НЛО прилетело и опубликовало эту надпись здесь
                                          • НЛО прилетело и опубликовало эту надпись здесь
                                            • НЛО прилетело и опубликовало эту надпись здесь
                                        • 0
                                          Менее 5% ДНК включает себя всю информацию о теле, на самом то деле.
                                          Остальное — нерабочие гены, мусор, следы от древних вирусов, результаты работы обратных транспозонов.
                                          Так что, вполне допустимо так говорить.
                                          • 0
                                            Извините, у вас устаревшие данные. Теория о мусорном ДНК уже отвергнута, как неверное. Было выяснено, что этот «мусорный» код крайне важен и сейчас идут его самые детальные исследования.
                                            • 0
                                              а можно, кстати, пруф в студию? (не то, чтобы я не верю, просто интересно почитать источник)
                                              • 0
                                                Да хотя бы вот: www.sciencedaily.com/releases/2009/10/091013105809.htm
                                                Also in 2003, researcher John Mattick stated in Scientific American that the failure to recognize certain types of «junk» DNA as functional was «a classic story of orthodoxy derailing objective analysis of the facts» that «may well go down as one of the biggest mistakes in the history of molecular biology.»

                                                История вопроса такова: были обнаружены большие фрагменты ДНК, которые, как показалось на первичном этапе исследования, ни на что не влияют, а являются просто мусором. Эволюционисты сразу заявили, что это просто остатки прежних мутаций генов и тому подобное, и объявили само существование этого мусора очередным доказательством эволюции. И исследования в этом направлении были в целом свёрнуты.

                                                Исследования продолжали лишь немногие научные центры. В итоге, результаты были получены и было обнаружено, что помимо кодирование белков ДНК содержит важную информацию по управлению жизнедеятельностью клетки и многое другое. Сейчас это передовая грань науки, но годы были потеряны, исключительно из-за предубеждений учёного сообщества. Процитированный выше Джон Мэттик как раз и относился к тем немногим исследователям, кто не свернул работы, и сталкивался с насмешками (типа, чего в мусоре копаетесь).
                                                • НЛО прилетело и опубликовало эту надпись здесь
                                                  • 0
                                                    Вообще-то Мэттик один из очень многих (по первой ссылке, кстати, упоминаются многие другие учёные, а о Мэттике и не вспоминают), кто соглашается с тем, что сейчас говорить о «мусорном ДНК» несколько неуместно. Более того, сейчас учёные гораздо более осторожны в том, чтобы хоть какие-то части ДНК называть «мусорными». То, что раньше отвергалось как мусорное, сейчас пересмотрено, а то, что ещё под вопросом, как вы верно заметили, активно исследуется.

                                                    Какое тут пренебрежение к области? Научное сообщество в целом отвергало исследование некодирующих ДНК, как бесперспективное, ибо эти части ДНК окрестили эволюционными отходами. Речь идёт не о некоторых отдельных представителях (как вы утверждаете), а о настрое отрасли в целом. Хорошо, что этот настрой изменился и исследования возобновили.

                                                    В общем, ключевые слова в гугле — Junk DNA, там очень много материала на эту тему.
                                                    • НЛО прилетело и опубликовало эту надпись здесь
                                                      • 0
                                                        Да, я видел, что там RNA, но там соседние статьи — про junk DNA (их там полно). С последним вашим утверждением согласен. В то же время, стоит быть осторожнее при высказываниях о бесполезности, т.к. прежние утверждения о «бесполезности» были местами опровергнуты. В общем, считаю, что тут осторожность с обеих сторон не помешает. Кстати, ключевые слова в выделенной вами фразе — «may be», т.е. это всё равно предположение.

                                                        Мне лично кажется вообще странными рассуждения о бесполезности в то время, как ясного понимания как именно и для чего вообще используется этот код до конца нет. Всё равно, что исследуя космос невооружённым взглядом или примитивными телескопами делать выводы о «пустых» областях, которые, как оказалось впоследствии при применении более мощных телескопов и телескопов, работающих вне оптического диапазона отнюдь не «пустые».

                                                        Вот когда ДНК будет окончательно расшифрован, всё будет разложено по полочкам настолько, что станет возможным симулировать жизнь на молекулярном (или даже атомном) уровне, вот тогда и можно будет окончательно утверждать о мусорности тех или иных частей, равно как и об «идиотичности» кода.
                                                        • НЛО прилетело и опубликовало эту надпись здесь
                                                          • 0
                                                            Ну, это уже религиозное :) И тут мы вступаем на опасную тропу Holy War, чего делать явно не стоит :)

                                                            Время рассудит.
                                                  • 0
                                                    Ну это не означает, что весь геном — полезен.

                                                    Результаты работы обратных транспозонов, которые просто встраивали и встраивали себя в ДНК раз за разом представляют собой огромное число повторов этого же кода. Они есть почти у всех видов, и постепенно все вырабатывают механизмы их подавления.
                                                    И тем не менее, часто мутации вызываются тем, что обратная трансляция приводит к встраиванию внутрь работающего гена.
                                                    • 0
                                                      Изначально вы утверждали:
                                                      Менее 5% ДНК включает себя всю информацию о теле, на самом то деле.
                                                      Остальное — нерабочие гены, мусор, следы от древних вирусов, результаты работы обратных транспозонов.
                                                      Я и сказал, что у вас устаревшие данные.Вопрос насколько полезны или не полезны те или иные части генома — это предмет самых активных исследований в настоящее время, так что делать окончательные выводы рановато.
                                                      • 0
                                                        С этим соглашусь, процент вполне может быть другим, надо что-то посвежее почитать.
                                              • +1
                                                Мусорный код разный.
                                                Минимум 30% это результат встраивания обратных транспозонов, какой от них толк?

                                                Вполне возможно, что те данные устарели, но вряд ли целикомю.
                                                • 0
                                                  См. мой комментарий выше.
                                    • 0
                                      Одно дело — сохранить свои данные в бинарном виде на флешку, другое — попробовать с неё загрузиться (при том, что ассемблер данного процессора не имеет полной документации)
                                    • +9
                                      Ждем в продаже домашних тараканов с несколькими Петабайтами памяти на борту.
                                      • +12
                                        Сейчас люди просто теряют флешки, а в будущем флешки будут сами разбегаться. Так прямо и видится: «На Проспекте Мира рядом с кафе убежал таракан с важной информацией. Рыжий, с усиками. Нашедшему — вознаграждение»
                                        • +21
                                          А еще из к примеру сотни тараканов можно сделать RAID.
                                          • +5
                                            «Черт! сдохли рекавери-тараканы!»
                                            • +9
                                              почему рейд сдох? не кормили…
                                              • +2
                                                конкуренты отраву подсунули
                                            • +33
                                              image
                                        • +6
                                          Представляю в будущем:
                                          «Скачай мне на молекулу игру GTA all world „
                                          • +4
                                            В будущем, вместо того, чтобы искать нужную книгу на полке будем вспоминать, в какое же из домашних животных что записали, а потом ловить их для считывания.
                                            Или ещё вариант, технология, по которой скушал птичку — усвоил информацию из ДНК, которую туда кто-то записал
                                            • +1
                                              Это как с супер способностями. Съел птичку а потом гадаешь, что в ней было.
                                              • +2
                                                Ну например какой-нибудь биологический вирус, предположим, заставляющий вас каждую пятницу в конце рабочего дня кукарекать, а чтобы излечиться от него, вам будет необходимо купить определённый рецепт
                                                • +1
                                                  Рецепт тоже должен где то храниться. К примеру в комаре или супер-сложный в шершне, а вместо коннектора укус(вместо прививки).
                                                  • +1
                                                    Дай укусить себя правильной пчеле. Раза с десятого в улье таком-то вы её обязательно найдёте, если ещё не передумаете
                                                    • +2
                                                      Кажется, вы придумали идею для следующей серии «Пилы».
                                                  • +5
                                                    пиво продают без рецепта.
                                                • +4
                                                  Ага, вот спамерам раздолье будет… Скушал птичку — а в голове мыли про увеличение некоторых органов появились…
                                                  • +2
                                                    А государство, пользуясь этим заставит всех любить партию власти, и только опытные био-программеры-кулинары будут выкладывать в паблик рецепты, как удалить этот вирус.
                                                  • +2
                                                    А хакеры будут заводить домашних комаров запрограммированных на сбор паролей с помощью укуса.
                                                  • +2
                                                    Главное, что бы не дошло до информационных DDos атак от полчищ мошек.
                                                    • +1
                                                      Или в руке пузырек (или просто участок кожи) с практически неограниченной емкостью данных.
                                                    • +4
                                                      «Джонни-мнемоник» скоро станет анахронизмом, резко перекочевав туда из фантастики, минуя реальную жизнь.
                                                      • +2
                                                        организме бактерии около 10 млн клеток
                                                        А разве бактерии не одноклеточные?
                                                        • +1
                                                          «Подавляющее большинство бактерий (за исключением актиномицетов и нитчатых цианобактерий) одноклеточны.» ©Вики

                                                          Не все.
                                                          • +3
                                                            А не подскажите какие бактерии состоят из 10 миллионов клеток? Я лично таких не знаю.

                                                            Полагаю в статье должно было быть написано «в одной колонии около 10 млн клеток»
                                                            • +2
                                                              В статье втором абзаце написано же:
                                                              В одном грамме бактерии около 10 млн клеток
                                                              • +3
                                                                Отрежьте мне, пожалуйста, грамм бактерии.
                                                              • +3
                                                                Thiomargarita namibiensis, не из миллионов, конечно, но сотни тысяч. Ещё под две сотни тысяч имеет Epulopiscium fishelsoni.
                                                            • +1
                                                              Может тут случайно попутали клетки и молекулы?
                                                              • +1
                                                                Мне тоже кажется, ибо ЕМНИП эшерихия коли (о которой речь в статье) — одноклеточная бактерия
                                                            • +3
                                                              Наклейка «Без ГМО» на столе в аудитории подтверждает, что стол может хранить информацию только нацарапанную на его поверхности.
                                                              • –2
                                                                640k хвати всем?
                                                                • +3
                                                                  640к штук молекул хватит всем
                                                                  • НЛО прилетело и опубликовало эту надпись здесь
                                                                • +8
                                                                  * В сторону:
                                                                  — Интересно, из какого кулинарного рецепта, записанного с ошибками на ДНК, появилось человечество?
                                                                  • +3
                                                                    Из рецепта пасты. РАминь!
                                                                    image
                                                                  • +1
                                                                    Читал, думал перевести =) Хорошо что кто-то не такой ленивый как я)
                                                                    Зетабайт в 13 граммах это круто!
                                                                    • НЛО прилетело и опубликовало эту надпись здесь
                                                                      • НЛО прилетело и опубликовало эту надпись здесь
                                                                        • +3
                                                                          «Ваше хранилище будет находиться в закрытом контейнере, это гарантирует, что ваши данные не убегут.»
                                                                          • +3
                                                                            Пошел пересматривать Джонни Мнемоника! )))
                                                                            • +2
                                                                              доказанная продолжительность хранения информации в ДНК составляет 3,5 миллиарда лет

                                                                              Кем доказанная? Как доказанная? Имеется ли хоть одна днк молекула такого возраста?

                                                                              В одном грамме бактерий около 10 млн клеток, а информационная плотность такого хранилища можно оценить в 900 ТБ на 1 грамм бактерий.

                                                                              Но от этого нет никакой практической пользы поскольку почти вся информация дублируется каждой клеткой. Уж если и будет человеком использоваться такая высокая информационная плотность, то за счет других технологий. А эти исследования интересны в проекции развития генной инженерии. Лично я считаю что потенциал генной инженерии огромен. Возможно, она окажет величайшее влияние на человечество.
                                                                              • НЛО прилетело и опубликовало эту надпись здесь
                                                                                • +2
                                                                                  Ну какая-нибудь инфузория туфелька или амеба фактически не изменилась за это время. Т.е. фактически берем ящик, создаем в нем стабильную микросреду из одного или нескольких бактерий, записываем в их ДНК информацию, обеспечиваем небольшой подвод тепла или света, и все, вечное хранилище в наличии. Бактерии дохнут быстро, но не мутируют как вид (так как уже идеально приспособлены под среду) и передают всю информацию по наследству (их почкование, это фактически полное копирование информации). Если мои познания в биологии слишком наивны, поправьте меня, кто в этом лучше разбирается.
                                                                                  • НЛО прилетело и опубликовало эту надпись здесь
                                                                              • +2
                                                                                бактерии ДНК отлично себя чувствуют при комнатной температуре
                                                                                Поясните смысл словосочетания «бактерии ДНК».

                                                                                (Может быть, логичнее было бы словосочетание «ДНК бактерий» в этом месте?)
                                                                                • +1
                                                                                  Так вот в чем смысл жизни. Мы — винчестер.
                                                                                  • +3
                                                                                    Ныне покойный товарищ Дуглас Адамс понял это более 34 лет назад, например. Советую почитать. 42.
                                                                                    • +3
                                                                                      ну, если быть точнее, то согласно его теории — мы не винчестер, а часть «настолько большого и мощного суперкомпьютера, что сама жизнь является его частью»
                                                                                      • +1
                                                                                        А что гениальная ж конструкция, компьютер на самообеспечении: 10% вычислительных способностей вычислительного кластера планетоидного типа отходит на самообеспечение юнитов энергией и комфортными для функционирования условиями, остальные 90% обсчитывают какую-то вселенскую задачу!
                                                                                        • +1
                                                                                          Это Вы «автостопом по галактике» вспомнили ?)
                                                                                          • +1
                                                                                            не знаю, я не читал. Стоит?
                                                                                            • +1
                                                                                              Клянусь рисками — стоит. Это же классика фантастики, рядом с которой стоият: Азимов, Стругацкие, Уэльс. Хорошая книга.
                                                                                              • +1
                                                                                                *никсами ** стоят… чтоб я ещё раз писал с планшета (
                                                                                                • +1
                                                                                                  Как-то, я это пропустил. Спасибо почитаю
                                                                                            • 0
                                                                                              а вы точно у d1gga хотели спросить, а не у меня? :)
                                                                                      • +2
                                                                                        приятно читать такие новости. Значит не оружием единым…
                                                                                        • 0
                                                                                          Вообще интересно, а кто нибудь пытался порыться в ДНК человека и поискать последовательности подозрительно похожие на текст? По идее они должны статистически выделяться. А то вдруг найдется «TCGCTCTTTCGATCGATCGGACAATTTGTCGGTGACTCGATCTAACAT».

                                                                                          Только полноправные пользователи могут оставлять комментарии. Войдите, пожалуйста.

                                                                                          Самое читаемое