Биовычисления по сворачиванию. Снова простым языком о полученной модели сворачивания

    Я тут написал уже более 7 статей на тему одного своего подхода (набора алгоритмов и проблем) к задаче сворачивания РНК. Читающих становилось с каждой статьей все меньше, а кое кто признавался, что мозг выносило уже после второй статьи. Сравнительный успех первых двух статей, по сравнению с остальными — кажется заключается в простоте изложения и не углубления в детали. Хотя последние статьи давали возможность самим взять демо моей программы и прочувствовать проблематику — это видимо интересует меньше.

    Поэтому я постараюсь тут изложить простым языком еще одну проблему, которая мешает решить эту задачу. И мне представляется, что эта проблема связанна не только с выбранным мной подходом к решению, а она скорее общая для задачи фолдинга.

    В своем ПО RNAInSpace — я реализовал возможность «покрутить» спираль РНК вручную, чтобы стала понятна геометрия и ограничения такого вращения. Но так как по предыдущим статьям — это ПО не сильно заинтересовало, то тут очередную демо версию этого ПО я пока представлять не буду. А поговорим о том, что получается у меня.



    Чтобы несколько поддержать разговор с моими читателями пройдусь по ряду их важных замечаний.

    chupvl уже спрашивал Вы тестировали ваше решение на реальной задаче, или просто разбираете теорию на данный момент? Там я ему пояснил так:

    Я сворачиваю рибозим. Рибозимы имеют одинаковую базовую структуру, точнее то из-за чего их выделяют в один класс. Для сравнения я использую другой реально имеющийся рибозим 2QUS. Мне потом важно увидеть в чем отличия, а в чем похожесть.


    Конкретный пример сворачивания

    А теперь хочу наглядно продемонстрировать, как выглядит та РНК которую я сворачиваю.

    Ниже «скелет» РНК, который я использую как базовый (2QUS).



    Я же пытаюсь свернуть вироидный рибозим NC_003540, третичная структура которого неизвестна. Но она должна быть в чем то подобна базовому. Хотя первичная последовательность у них почти на 80% разная. Ниже один из наилучших вариантов, которые мне удалось получить. (не автоматически, а полуавтоматически — аналогично как если бы играть в игру FoldIt только другим способом, я уже как то говорил, что до полной автоматизации — как до луны)



    Какие отличия мы тут можем видеть?
    1. Надо понимать, что базовая последовательность (2QUS) несколько длиннее, чем в вироидном рибозиме, поэтому концы РНК в вироидном рибозиме не будут образовывать длинную спираль, как в базовом аналоге.
    2. Общая укладка принципиально совпадает — поэтому вироидный рибозим принципиально свернут верно.
    3. Но есть как минимум одно отличие. Петля L2 (см. участок на рисунках слева снизу) — отличается.
    3.а. В этой петле есть один нуклеотид, который должен образовать 4 водородных связи с двумя другими нуклеотидами в петле L1 (участок на рисунках справа снизу). Именно эти связи и удерживают петли рибозима вместе.

    (как это наглядно выглядит и какие тут проблемы, которые я уже решил — я комментировал ранее здесь и здесь)

    3.б. Почему же существует отличие? В базовом рибозиме эта петля просто длиннее, чем в изучаемом мной вироидном рибозиме, и петле L2 приходится менять свою конфигурацию, чтобы она могла состыковаться с петлей L1. А так как это достаточно неестественное положение петли L2, вместе с этим должна меняться конфигурация самой спирали (то, что выше слева).

    4. И наконец, после разрешения всех этих проблем, я уже потирал руки, думая, что свернуть то концы рибозима при достаточно правильном положении ядра рибозима — не составит проблем. Но ошибся. Мне так и не удалось образовать нужные водородные связи между концами спирали (на рисунке можно видеть, что концы находятся не достаточно близко друг к другу).

    Почему же не удалось досвернуть рибозим?

    Я начал сравнивать, в чем же проблема у структуры РНК свернутой мною. Концы не хотели сходится, т.к. им мешал выступ соединяющий спирали L1 и L2 (по центру сверху). И оказалось, что буквально один-два нуклеотида, после этого выступа заняли не верное положение. Им в моделировании не очень много отводилось внимания. Они не образовывали никаких водородных связей — и я им позволил принимать любое возможное положение. И они приняли — случайное. И естественно, случайное положение не позволило досвернуться рибозиму. (ответвление: только подумайте — как может, что-то получится при моделировании, если в большинстве теперь используемых методах нуклеотиды как раз ставятся в случайное положение, а выбираются правильные по каким то среднестатистическим для всей молекулы РНК показателям?)

    Я попробовал изменить это положение в уже свернутой структуре (второй рисунок). Но это оказалось не возможно — нужно перестраивать практически все связи, т.е. разрушать все те водородные связи которые уже были образованы.

    И тут я задумался. Вспомнил комментарий от Wott: начальное состояние диктует результат, и ранее

    И собственно начальное положение и диктует какое именно «конечное» состояние будет достигнуто. А начальное состояние в этом случае — сам процесс создания цепочки. То есть по хорошему задачу надо решать итерационно — добавили первый, добавили следующий — привели систему в минимум, добавили следующий — опять привели в минимум.

    Точно также вредно рассматривать вытянутую цепочку целиком — это неправдоподобное состояние из которого можно достигнуть как правдоподобного, так и не очень состояний, но в силу большой величины вариантов, вторых будет существенно больше.


    Это достаточно верное замечание, и для меня оно было известно, ранее в одной своей научной статье я писал:


    В терминологии теории игр это означает, что нужно обеспечить возможность из любого начального положения игры достичь заданного конечного состояния. И если, например, в игре в шахматы мы знаем, как начинается игра и какое условие выигрыша, и знаем, что правилами шахмат обеспечено попадание из начала игры в конец, то здесь — при моделировании сворачивания макромолекул — нам нужно еще найти такие правила и доказать, что они обеспечивают процесс сворачивания.


    Поэтому тогда я и ответил в целом, что такой подход противоречит моим результатам, и что лучше уж начинать сворачивать из начального состояния вытянутого в цепочку, чем из полусвернутого.

    Но существуют еще так называемые стэкинг взаимодействия: это когда нуклеотиды, которые упрощенно можно назвать шестиугольниками расположены так, что образуют как бы стопку монет. Ниже на рисунке первые 6 нуклеотидов (считая снизу) находятся в стэкинг взаимодействии.



    Так вот если РНК появляется постепенно, то до того как может образоваться первая водородная связь нужно чтобы появилось как минимум двадцать нуклеотидов.

    И раньше я считал, что они просто вытянуты в цепь. Но они на самом деле наверняка появляясь один за другим успевают принять положение свойственное стэкингу. И цепочка вроде как вытянута, но уже не совсем случайно. И это вот как раз и важно для начального положения.

    Но тут оказалась еще одна неприятность. Если мы вспомним как выглядит двойная цепь ДНК — то её длина может быть сильно большой. А там как раз именно такие стэкинг взаимодействия. Но РНК хотя и стремится к этому, но её хватает только на очень не большие участки, и тут на третьем рисунке вы видите как начиная с 7 нуклеотида цепь РНК меняет направление.

    Некоторые выводы

    Наверное не очень понятно к чему я вел все это время. Попробуем разобраться.

    1. Стэкинг оказывается важен как создание начального положения, которое способствует тому, чтобы при сворачивании в природе не получилось ситуации как у меня, в описываемом выше моделировании, когда РНК практически свернулось — но пару нуклеотидов остались в случайном положении (не связанные стэкингом) — и это мешает дальшейшему сворачиванию.
    2. Стэкинг РНК не такой стабильный как в ДНК, где образуется строгая спираль. У РНК в некоторых узловых точках прекращает между парой идущих друг за другом нуклеотидов действовать силы стэкинга. И тогда цепь меняет направление.
    3. Там где меняется направление цепи, и тогда когда находятся комплементарные пары нуклеотидов — то вот тогда и начинают создаваться водородные связи, которые имеют более сильное стабилизирующие действие, чем стэкинг.
    4. Но когда цепь вырастает, и разделяется на две и больше спиралей — петли этих спиралей соединяются между собой нестандартными водородными связями. Это еще более сильное взаимодействие, и в это время может рушится предшествующий стэкинг, приближение водородных связей, и меняться форма начиная с петель спиралей.

    Вот это та гипотеза — модель сворачивания, которая мной получена на данный момент. Её еще надо проверить окончательно, но сейчас проверены как минимум многие другие вариации, которые не могут быть справедливыми (типа иерархической модели (где говорится вначале о создании вторичных структур, и только потом их совмещении в третичную) и прочих).

    В итоге получается, что задача стэкинга подтолкнуть к образованию нужных водородных связей. А без его наличия водородные связи сами по себе не образуются.

    P.S. На самом деле, все немного сложнее, но не хочу вас грузить. И так похоже обещал просто, а получилось не совсем. Но готов ответить на любые вопросы, где что-то не ясно.

    Similar posts

    Ads
    AdBlock has stolen the banner, but banners are not teeth — they will be back

    More

    Comments 75

      +1
      Тема интересная, правда я мало чего понял :)
      После прочтения возник дилетанский вопрос — вот вы рассматриваете начальные состояния и способы сворачивания из них. И получается, что все это влияет на конечный результат. А можно ли взять задачу наоборот — взять конечное состояние (как я понимаю, это уже готовый свернутый белок), оно уже известно, т.к. структуры белков изучены и смоделировать процесс «разворачивания», к примеру поменяв знак притягивания-отталкивания. Таким образом получим начальное состояние и посмотреть что оно из себя представляет, вытянутая линия ли это или клубок.
        0
        Здесь мы говорим о РНК, а не белках. Почему — Часть №1. Введение в биовычисления по сворачиванию. От белков к РНК. Но проблемы конечно сходные, просто у белков будет сложнее.

        Надо понимать, что вытянутая линия в природе не бывает — это идеализация. Цель этой идеализации было посмотреть, а есть ли вообще разница в начальном положении. Получается, что есть, хотя может оказаться, что можно свернуть достаточно далеко — и лишь потом, неправильное начальное положение окажет своей действие.

        С другой стороны, если сворачивать вообще из начального положения клубок, но случайного — то будет еще сложнее — цепь просто не развернется, чтобы свернуться.

        Средний вариант я как раз тут и описываю, и почему я к нему пришел.

        Что касается вашего вопроса, а если сделать наоборот? С одной стороны, конечно это можно сделать — причем развернуть легче. Но также существует множество вариаций это сделать. И в отличии от процесса «от начального к конечному» — мы не будем знать точно критерии к чему стремится. Т.е. будет еще сложнее.
          0
          Множество вариаций конечное? Если да, может среди них посчитать минимальную энергию?
            0
            Ну как конечное? Конечное, но выражается астрономическими цифрами :)
          0
          Впрочем, я еще раз подумал. Мы можем определить геометрическую энтропию как желание увеличить свою свободу произвольно вращаться. Тогда если уже в свернутой цепи, начать постепенно увеличивать такую энтропию — то мы сможем выявить те нуклеотиды «слабые звенья», которые потеряют водородные связи вначале, а что затем. Это произойдет не сразу, и все же будут различия (не все связи порвутся одновременно). Затем получится некое промежуточное состояния, в котором, скорее всего, еще будут видны зачатки воздействия стэкинга, но с увеличением энтропии и это потеряется.

          Это надо проверять, но похоже это будет работать лишь в другом направлении как сворачивание, принципы которого я изложил в этой статье — в выводах.
        • UFO just landed and posted this here
            0
            ???
              0
              Видимо имелась цель сказать, что чувак ничего не понял из статьи, и я его понимаю. я тоже после прочтения почувствовал себя дикарем.
                0
                Наверное полезно тогда начать с Часть №1. Введение в биовычисления по сворачиванию. От белков к РНК. К сожалению, есть некоторый порог вхождения в тему — как и везде впрочем, но на мой взгляд, — оно того стоит. Я тоже года 4 назад вообще ничего не понимал в этом, и даже книги в этом мало помогали.
                  0
                  Ну, или может есть конкретные вопросы? Что именно не ясно?
                    +2
                    Рекомендую просто при написании серийных постов после долгого перерыва приводить в шапке ссылки на предыдущие статьи цикла. Тогда читатель сразу увидит, что он не «дикарь», а просто тема специализированная.
                      +1
                      В прошлых статьях, я это делал. Но тут я хотел как раз подчеркнуть, что тем не столь специализированна как кажется. И для понимания этой статьи не обательно прочтение чего-то еще. Минимум нужны знания, описанные в первой части — по сути знание школьной биологии.
                        +1
                        По сути же тут нет ничего специального — смотрим на картинки и все понимаем :) Не, ну честно… единственно возможно есть несколько непривычных терминов, но необходимы я же поясняю…
                          0
                          Лично мне все понятно и интересно — это просто было пожелание для удобства ориентирования не привыкших еще юзеров. Сам пока еще не спец, но присматриваюсь к этой теме на дальнюю перспективу с позиции широкопрофильного ИТшника: что можно будет сделать полезного в ближайшие годы в плане железа и софта, чтобы это вызвало какую-нибудь disruptive инновацию в биологии; что для этого актуальнее всего учить, каковы перспективы в этой сфере у стартапов или краудфандинговых инициатив и т. д.
                            0
                            Спасибо за интерес, как на счет поучаствовать в данном стартапе :), скажем начиная с пробы демо версии моего ПО, на котором я проверяю свои идеи?
              • UFO just landed and posted this here
                  +2
                  Я честно говоря, не вправе отвечать на такие вопросы, я не биолог. Но вот, что мне кажется, такие белки — это скорее крупный функциональный механизм. Эти белки имеют все равно участки, которые стабильно сворачиваются. И совсем другое дело, что под действием некоторых стимулов (контактов с другими белками/РНК, атомами и т.д.) они начинаю работать, изменяя свою конформацию. У этих белков видимо степень изменения достаточно большая.

                  К вашим вопросам:

                  1. У РНК все несколько проще, скорее из-за их не большой длины. Но вот чем интересен именно этот рибозим, сворачивание которого я тут описывал. Он имеет замечательное свойство саморазрезаться. После чего эти части аналогично комплементарным связям как в ДНК достараиваются — и в итоге происходит размножение. Как я понимаю вопрос о сшивке остается открытым, но тем не менее достоверно известно, что такие РНК саморазмножаются. Таким образом, можно говорить о наименьшей «живой» молекуле.

                  Так вот такие свойства это РНК конечно не могут получится в статике. Не закрепленные никакими связями отдельные нуклеотиды продолжают флуктуировать. Но в данном рибозиме, все связи образованны так, что они специально подталкивают крайнею близость «выступа соединяющего спирали L1 и L2 (по центру сверху)» с одним из концов спирали — это место как раз место разреза.

                  2. Поэтому то, что мне не удается смоделировать сворачивание концов — можно еще объяснить тем, что в этот момент на самом деле происходит разрезание. А биологи получают состояние уже после разрезания. Т.е. само сворачивание приводит к тому, что молекула разрезается.

                  К сожалению точных критериев тут нет. Сейчас кажется, что это ошибка — и вообще-то надо проверить другие варианты — все возможное поле вариаций. Только тогда можно понять, что в реальности происходит что-то такое, что не учитывается в моделировании. Причем надо показать, что это происходит с необходимостью.

                  3. Какие способы? Как можно понять из моих статей, одна из претензий к существующему подходу — это как раз использование случайности и статистического подхода. Я против такого подхода, т.к. уверен, что он совершенно не характеризует состояние макромолекулы. Силы и состояния в молекулы, совершенно разные не только в разные моменты, но и в каждом месте. Поэтому моделировать это можно лишь учитывая различия происходящие в разных местах.

                  Нужно определять не обще статистические параметры молекулы, как например, достижение минимальной энергии. А такие параметры, которые характеризуют сворачивание в отдельных местах — наличие стэкинга, стремление к образованию водородных связей и т.д. Когда это выполняется, то можно быть уверенным, что сворачивание произошло верно. Это не будет выполняться — если чего-то не хватает для сворачивания. К примеру, для образования отдельных спиралей — совершенно не важно учитывать стэкинг, но для многоспиральных это становится важным. Так вот для таких «динамичных» белков ( IDPs) или близких аналогов РНК — может быть важно учитывать что-то еще. Как правило тогда появляются как раз те стимулы-активаторы (медиаторы, их кажется называют), которые и управляют «динамикой» сворачивания/разворачивания. И вот их и нужно думать как учитывать в моделировании… но это будет еще сложнее, чем то что я пытаюсь сейчас сделать.
                  0
                  А GROMACS вы в своих работах не думали использовать?
                    0
                    А чем он мне может помочь? Имеется ли у GROMACS открытый код? Если нет как его можно использовать, если не совершенствовать?
                      0
                      Ну и потом там используется т.н. «молекулярная динамика», что вообще-то я своим подходом — критикую, как излишнее усложненный и не практичный подход к моделированию :) (впрочем, если бы кто-то на пальцах это могу бы доступно рассказать и пояснить, чем «молекулярная динамика» хороша — можно было бы подискутировать, но копать в этом направлении самому — считаю малоинтересным и не перспективным)
                        0
                        И если, что-то использовать от молекулярной динамики — то NAMD, т.к. визуализатор VMD — я как раз уже переписал и использую как отображение графики (см. История одного реинжиниринга или RNAInSpace v.1.3. Demo)
                          0
                          Ну я просто искал что-нибудь, чтобы моделировать мицеллообразование небелковых молекул (включая кулоновские взаимодействия ионов по particle mesh evald), и пока мне импонирует именно gromacs. Да, это GPL-программа, есть в репозиториях любого дистрибутива, один из самых быстрых пакетов молекулярного моделирования, есть встроенный визуализатор и пакеты для анализа полученных данных, списки рассылки проекта, и gromacs manual с описанием всех алгоритмов и т.д. и т.п. Смоделировать мне нужно, к примеру, взаимодействие этого: image
                          с этим:
                          image
                          При этом важно учесть влияние растворителей, потому что в хлороформе они дают устойчивый трехмерный гель, а в воде и метаноле этого не наблюдается, что логично, учитывая сольватацию ионов и разделение ионных пар. Будет ли лучше использовать NAMD для этого?
                            0
                            В этом я ориентируюсь как раз плохо. Получилось смоделировать? может напишите на хабре статью? Было бы интересно…
                              0
                              Пока что я только получил заряды на всех атомах с помощью французского R.E.D.-сервера, теперь буду пытаться перевести мои молекулы в понятный gromacs вид (они ведь небелковые, будут грабли) и начинать думать над параметрами моделирования. Gromacs вроде более-менее законченный пакет, меня как непрограммиста он пугает менее всего. Если все получится, то обязательно напишу статью.
                                0
                                Если интересно, могу дать контакт друга, который занимается разработкой RED-подобных зарядов, ему как раз надо протестировать их на чем-то большем.
                                  0
                                  В смысле на больших молекулах? Да, давайте.
                                    0
                                    спрошу его — и перешлю контакты
                        +1
                        Уважаемый tac, не поймите как поклеп лично на вас, НО, по фолдингу РНК ТЬМА литературы, просто огромное количество! теперь вы говорите о учете стэкинга, потом вы начнете говорить о учете других параметров, в итоге придете к комбинации силового поля и статистических потенциалах, о которых я вам говорил 3 поста назад.

                        Продолжаю — вам будет необходимо силовое поле (force field), которые будет себя вести адекватно данной биологической мишени, универсального пока не создали. Оно должно учитывать все вероятные взаимодействия между RNA — водородные связи, ван-дер-Ваальсовы взаимодействия, pi-pi и катион/анион-pi стэкинги, а если там еще и метал есть, который стабилизирует фолдинг, то добавьте еще специфических взаимодействий.

                        Литература
                        К примеру смотрите сюда
                        DNA Polymorphism: A Comparison of Force Fields for Nucleic Acids
                        www.cell.com/biophysj/abstract/S0006-3495(03)74957-1
                        или сюда
                        RNA Folding: Conformational Statistics, Folding Kinetics, and Ion Electrostatics
                        www.annualreviews.org/doi/abs/10.1146/annurev.biophys.37.032807.125957?journalCode=biophys

                          0
                          В том то и дело, мне не понадобится НИКАКА физика или химия. О водородных связях и стэкинге речь идет только в терминах геометрического расположения молекул.
                            0
                            говоря о геометрии, вы как раз и частично используете силовое поле.
                              0
                              используя только геометрия без силовых потенциалов вы немногого добьетесь
                                0
                                Что дают силовые потенциалы?
                                0
                                В чем связь?
                              +1
                              Литература говорите, вы мне лучше покажите программу которая сворачивает РНК, причем только с вводом первичной последовательности и предполагаемых водородных связей. Зачем мне читать сказки на ночь, которые не приближают к результату не на грамм? Для общего развития, спасибо — лучше фантастику Лема почитаю.
                                0
                                не моя специальность, но мне кажется пока это маловероятно :) копипастните сюда последовательность (без водородны связей) — попробую на доступных программах
                                  0
                                  Спасибо.

                                  aagaggucggcaccugacgucgguguccugaugaagauccaugacaggaucgaaaccucuu

                                  Расскажите, даже если будет отрицательный результат. А лучше статью на хабре :)
                                    0
                                    статья к сожалению отнимает тьму времени :( минимум час
                                      0
                                      Ну, это же не сравнимо если пробовать получить результат на «доступных программах», кстати, что вы собираетесь использовать?
                                        0
                                        использовать — все доступное
                                        мне необходимы условия
                                        1. Последовательность (уже есть)
                                        2. С какой структурой сравнивать — тк критерий сворачивания это RMSD — среднеквадратичное отклонение.
                                          0
                                          Тут у вас будут проблемы, впрочем…

                                          Давайте возьмем, ту с которой сравниваю я интеллектуально (моя программа об этом не знает) — 2QUS
                                            0
                                            2QUS — это то, что вы пытаетесь свернуть?
                                              0
                                              Нет, это то с чем сравнивать! То, что я пытаюсь свернуть в PDB нет.
                                                0
                                                а как вы будете оценить «правильность» сворачивания? одна-две базу могут «повернуть» сворачивание совсем по другому.
                                                  0
                                                  Вы вначале дайте хоть какой-то вариант — я оценю визуально. И это будет супер защита от мухлежа подобных алгоритмов.

                                                  Знаете это похоже вот на что, из области АИ:

                                                  1. предлагается конструкция машины, предназначенной для моделирования человеческого мозга, который не описан;
                                                  2. подробно описанные характеристики машины полагаются аналогичными характеристикам мозга;
                                                  3. затем делается «открытие», что машина ведет себя подобно мозгу;

                                                  порочность состоит в «открытии» того, что было постулировано".
                                                    0
                                                    Зачем Вам по ходу решения знать готовое решение? Я чувствовал не доброе, но похоже оно реально так пахнет…
                                                  0
                                                  Я понял. Вы наверное это не сможете :)

                                                  Хорошо, давайте тогда смоделируем 2QUS — попробуйте её получить in silico, правда там не приятность в PDB файле нет водородов, поэтому лучше использовать первичную последовательность, по которой достроить водороды.
                                                    0
                                                    нет, уж :) давайте сами!

                                                    в wiki куча ссылок, я думаю вам будет интересно проверить сначала литературные данные и известные алгоритмы, чем городить лес абстракций. А то это получается псевдонаука, а не наука
                                                      0
                                                      Нет. Это интересно мало. Наука не заключается в том, чтобы проверять все абсурдные варианты, которые не дают результатов.
                                                        0
                                                        Я пас. То, что вы делаете к науке имеет слабое отношение.
                                                          0
                                                          Это увы, ваше сугубо частное мнение.
                                                            0
                                                            Да я понял, что вы пас, т.к. не получится вам продемонстрировать результат того, что я вас прошу. Но с пеной у рта, будем доказывать, что есть куча литературы, замечательных алгоритмов и т.д. — Результаты где? Это вот как раз и не наука — а лишь публикация сказок.
                                                  0
                                                  Хотя странно, что как критерий используется среднеквадратичное отклонение от того, что знаем. Такое великое поле для мухлежа- идем и стремимся достичь те углы, которые есть у образца — что может быть проще :)
                                                    0
                                                    Ну и к сведению, что

                                                    Считается, что величина RMSD не может служить достоверным показателем степени свернутости биологической молекулы. В данной работе авторы применительно к РНК предложили использовать величину «нативная характеристика» — NC, которая была определена как разница количества межатомных контактов, присутствующих в нативной конформации и количество контактов, не характерных для нативной конформации
                                                    Does Water Play a Structural Role in the Folding of Small Nucleic Acids?


                                                    что хорошо согласуется с моими выводами, которые я раньше тут излагал.

                                                    Поэтому не стоит тут вести разговор ad hominem, и решать что есть наука, а что нет. Может надо просто разобраться в теме и угле зрения о котором тут говорится, и обновить свои устаревающие знания?
                                                      0
                                                      Ну, и так к слову заметьте сколько им потребовалось CPU для их экспериментов? — 150'000 CPU. И это для молекулы всего в 12 нуклеотидов, и кстати использовался GROMACS.

                                                      Все хорошо, — у них были другие цели. Но, кстати сказать, такую мелкую молекулу — я сверну за пару суток — на одном процессоре.
                                              • UFO just landed and posted this here
                                                  0
                                                  Вообще-то да, прошу дать трехмерную модель. Что касается двумерной — у вас она получилась не верна —

                                                  правильная



                                                  кроме того на ней не отображены еще неканонические пары —

                                                  a44 — u15
                                                  a44 — u20
                                                  с28-g33

                                                  не знаю что вы использовали, но двумерные модели хорошо дает RNAfold web server

                                                  но он конечно дает только каннонические пары.
                                                    0
                                                    Блин, ошибся ссылкой


                                                    • UFO just landed and posted this here
                                                      0
                                                      Причем ошибся ДВАЖДЫ, извиняюсь

                                                      вот правильная вторичная структура

                                                      • UFO just landed and posted this here
                                                        0
                                                        > Думаю проработать вашу идею и через неделю написать что-то по существу, если получится.
                                                        Спасибо за интерес, как на счет поучаствовать в этом несколько глубже? На раз тут сложно, что-то сделать… не хотите попробовать демо моей программы?
                                                  0
                                                  Но похоже вы опять читали, по горизонтали. Да, я говорю о учете стэкинга. Но и более того, я говорю какую роль играет стэкинг в процессе сворачивания. Покажите мне хоть одну книгу/статью где об этом говорится?
                                                    0
                                                    Base-stacking and base-pairing contributions into thermal stability of the DNA double helix
                                                    nar.oxfordjournals.org/content/34/2/564.short

                                                    это первое что под руку подвернулось
                                                      0
                                                      Ну там же о ДНК :) Причем судя по названию речь о том, какой вклад в стабильность ДНК, а не о том как это способствует сворачиванию.
                                                        0
                                                        вы думаете огромная разница между энергией pi-pi взаимодейстий? вы заблуждаетесь!
                                                          0
                                                          Причем тут энергия? Я вам о логике сворачивания, а вы мне о физике… это не серьезно.
                                                    +1
                                                    И потом, самое главное осознать, что задача фолдинга — это не задача физики или химии :) Что и отличает мой подход — нет ничего кроме углов и расстояний, и правил какими они должны быть и стремится. По сути это задача конструирования механизмов, причем конструирования именно в плане соединения деталей. И задача как бы стоит достаточно обще — как вообще можно проектировать вариации соединений, чтобы их не разрушила энтропия. Конечно, это фантастика сейчас… но реальность делаем мы :)
                                                      +1
                                                      Причем энтропия в этом случае — это совсем не физическая сущность, а геометрическая. Мера того на сколько можно провернуться в пространстве не столкнувшись с другими объектами.
                                                        0
                                                        Т. е. в РНК нет своих аналогов гидрофилии и гидрофобии, как в Foldit, тут все решают только внутренние связи, которые зависят от кода? т. е. «петли» внешними сторонами друг на друга никак не влияют, кроме того, что физически занимают пространство?
                                                  0
                                                  стэкинг. Если закрутить нитку, то образуются такие же ответвления. Причина этого мне не известна, но похоже имеет место закон сохранения закрученности. Есть ли такой закон для полимерных цепочек, в частности, РНК?
                                                    0
                                                    Не вы ли мне задавали вопрос, про то имеет ли отношение к вопросу сворачивания волос, который скручивается :)

                                                    Ну — волос это белок, поэтому скручивается тоже по правилам полимерных цепочек. Но вопроса вашего я не понял…
                                                      0
                                                      Как и предыдущий вопрос, этот направлен на попытку перенести задачу на макроуровень, чтобы она стала более наглядной, так как подобное моделирование может оказаться полезным. Если крутить нитку, то могут появиться сдвоенные ответвления, которые сами закручиваются в противоположную сторону, как бы компенсируя закручивание. Немного прояснила википедия: Суперскрученность. Показалось, что более правильная форма скручивания будет более наглядной и простой для понимания и может послужить базой(форма сворачивания по умолчанию) для понимания более сложного сворачивания(модификация базовой формы), например, РНК.
                                                      «Но вопроса вашего я не понял…» — если это относилось к вопросу про волос, то там я представлял как рибосома синтезирует белок: точка добавления аминокислоты напомнила точку между ногтями, перемещающуюся по волосу. Возник вопрос насколько далеко можно распространить аналогию: зависит ли форма белка от скорости его синтеза, при каких условиях можно получать стабильную форму волоса на выходе и т.д.
                                                    0
                                                    Я вот ни разу не учёный, но смотрите какая шутка получается:
                                                    * я так понял, РНК всегда свёрнута одинаково, для всех экземпляров молекулы
                                                    * конечная конфигурация молекулы не обязательно будет глобальным энергетическим минимумом ( вы картинку из википедии постили, где это иллюстрируется)

                                                    Т.е. по идее молекула может существовать в нескольких стационарных конфигурациях, но получается почему-то только одна. При этом, поправьте меня если это не так, но вроде бы нет экспериментов в которых бралась бы развёрнутая в линию РНК и она бы сама свернулась обратно в свою правильную форму.

                                                    Я говорю о том, что, похоже что, моделировать сворачивание целой молекулы смысла нет — она в природе не бывает вот такой вот вытянутой в линию и всё равно в правильную структуру не свернётся. По-моему достаточно очевидно, что молекула начинает сворачиваться по мере того как она строится, вот исходя из этого и нужно плясать.

                                                    Only users with full accounts can post comments. Log in, please.