Генная инженерия от A до Z

    Приветствую уважаемое сообщество!

    Итак, это мой первый пост на хабре :)
    Посвящен он будет серьезной теме, в которой, волею судеб, я неплохо разбираюсь. А именно, генной инженерии.

    Помнится, тут пробегал пост в котором говорилось о геннотехнологической лаборатории “на коленке”. Оказалось, что тема интересна аудитории, поэтому я решил заняться ее развитием с просветительскими целями.

    Я буду давать наглядные и понятные обычным людям примеры для описания сложных процессов. Если кто-то посчитает нужным меня поправить – не стесняйтесь. Я буду сознательно упускать многие вещи, но если вам кажется, что без них страдает логика изложения – так же поправляйте.


    Итак, начнем. Допустим, мы хотим создать трансгенную новогоднюю елку светящуюся синим светом. Допустим, британские ученые как раз недавно открыли ген синего свечения. Вот и посмотрим на этот процесс по стадиям.

    Ген свечения.

    Будем вести эксперимент, как настоящие ученые. Они слышат что открыт новый ген, что же им делать дальше, если хочется создать елку?
    Настоящий ученый обычно лезет в ncbi.nih.gov и по нескольким ключевым словам ищет научные публикации на эту тему. Например “синее свечение ген светится”. Типична ситуация, когда по одной из ссылок он действительно находит статью “британских ученых”, которая оказывается статьей группы китайских авторов, ни один из которых не отзывается на e-mail.
    С другой стороны, в статье можно выяснить название этого гена. Пусть он будет называться ButiBl1 (названия генов принято давать буквенными обозначениями + индекс, а впереди может идти несколько первых букв названия организма из которого он выделен, их можно отбрасывать). ButiBl1, например, может быть расшифровано как Butiavka marina blue light 1 gene. Но правила здесь не строгие.

    По названию гена в базе данных нуклеотидов ищут последовательность гена.Вот что примерно видит ученый на экране.

    Кстати, мы можем воспользоваться инструментом BLAST и введя последовательность ДНК, получить, к каким генам она может относиться. Это тоже очень важный рутинный инструмент для генных инженеров.

    Итак, мы получили последовательность гена. Очень хорошо, что дальше? Нужно ведь получить сам ген. Для этого вернемся к вопросу о том, что такое ДНК.

    Про ДНК.

    ДНК – это длинная молекула (очень длинная), является полимером из четырех вариантов маленьких молекул – азотистых оснований, попросту “букв”.

    Геном клетки разбит на части — от одной до нескольких десятков молекул ДНК, причем обычно у каждой из них есть еще и своя копия -близнец, несущая те же гены. Каждая из молекул ДНК особым образом свернута чтобы поместиться в клетке и покрыта белковыми комплексами, образуя хромосому.

    Я надеюсь, все это помнят, но если нужно освежить память, пожалуйста, в wiki :)

    Итак, запомните главное:

    1. ДНК – это молекула.
    2. Так как это молекула, то ее не видно в микроскоп, не подцепить пинцетом и т.д. и т.п.
    3. В клетке считаное количество молекул ДНК, причем если их много, то они разнородные и «собрать их пучком» чтобы подцепить пинцетом (пункт 2) тоже не получится.

    Как же генные инженеры работают с молекулой ДНК если она одна и с ней невозможно провести никаких прямых манипуляций? Дело в том, что во всех процедурах происходит работа не с одной, а с множеством молекул ДНК, с тысячами и миллионами ее копий.
    Тысячи таких одинаковых молекул плавают в водном растворе и этот раствор называется “препаратом ДНК”. Все манипуляции с молекулами проводятся типичными химическими методами.

    То есть ученые работают не с одной молекулой, а с огромным их количеством в растворе с применением химических методов.

    Как же нам получить ген bl1? Есть два способа. Первый – прямой химический синтез. Однако им не получить достаточно длинные молекулы из-за ошибок синтеза. Поясню, почему.
    ДНК – это полимер. Его можно синтезировать наращивая по кирпичику, причем есть четыре кирпича разных цветов. На каждой стадии наращивания эффективность составляет порядка 99%. То есть из ста молекул одна получается неправильной. Теперь представьте, что нам нужно сделать молекулу длиной в 1000 букв? Тогда применяя банальную арифметику окажется, что доля верных молекул составит 0,99^1000=0,00004
    Учитывая, что разделить верные и неверные молекулы почти невозможно, наша затея тут потерпит фиаско, и в реальных задачах синтез более 100-150 букв уже представляется малореалистичным.

    Остается второй способ.

    Потрошим бутявку

    Мы выбиваем из шефа командировку на побережье Мальдивских островов, где только и водится пресловутая бутявка морская (Butiavka marina).

    Ловим ее, толчем в порошок, заливаем последовательно разными химическими гадостями чтобы из всей массы тканей в растворе остались только молекулы ДНК. Конечный итог этого – препарат ДНК бутявки. Так как выделение производится из относительно большого образца, то там не одна молекула ДНК, а много – от каждой клетки по паре штук. Эта ДНК содержит не только ген bl1, но и все остальные бутявочные гены.

    Этот этап называется выделением ДНК. Ее можно выделить не только в виде раствора, а переосадить и получить сухой препарат, то есть чистые молекулы ДНК.

    Амплификация

    Итак, командировка окончена, поэтому мы метнемся обратно в лабораторию где нас поджидает чудная процедура амплификации.

    Смотрите, в препарате ДНК бутявки куча всяких разных генов, а не только нужный нам. Мы же можем работать только с однородными препаратами, нам нужно довести содержание молекул ДНК гена bl1 хотя бы процентов до 90.
    И тут мы применяем поистине чудесный прием, являющийся краеугольным камнем современной биоинженерии, называемым полимеразной цепной реакцией или ПЦР (polymerase chain reaction, PCR). За открытие этого метода присудили нобелевскую премию, хотя до сих пор ходят споры о приоритете, поэтому фамилий не называю, кому интересно – почитайте.

    Принцип полимеразной цепной реакции довольно сложен, объяснение дам очень грубое и только для того чтобы было хоть какое-то представление, за подробным – добро пожаловать по ссылке выше.

    Итак, нам нужно размножить (амплифицировать) молекулы ДНК определенного гена. Для этого мы открываем страничку с последовательностью нашего гена и находим его концы. Берем 20-30 букв с конца и столько же с начала и синтезируем короткие молекулы ДНК химическим синтезом (обычно это делают специальные фирмы)

    То есть мы имеем две новые пробирки. В одной из них плавает много коротких 30-буквенных последовательности ДНК, гомологичных началу гена, а во второй – то же самое, но для конца гена. Эти новые молекулы называются праймерами.

    Теперь мы запускаем реакцию ПЦР, причем умножаться у нас будет участок между двумя праймерами (между начальным и концевым). Реакция ПЦР – это биохимическая циклическая реакция, требующая смены температуры. В свое время ее делали на водяных банях, теперь же используют специальные приборы – амплификаторы (они же ПЦР-машины). Их строение очень простое, там стоят элементы Пельтье, есть место для пробирок и ко всему этому присобачены электронные мозги и управляющая панель.

    image

    То есть вернулись мы в лабораторию с ДНК бутявки. Заказали два праймера — к началу и к концу гена. Потом взяли чистую пробирку, капнули туда чуть-чуть ДНК, чуть чуть каждого праймера, полимеразу (фермент, который строит ДНК), нуклеотидов для строительства ДНК, и немного солей для правильной работы фермента, поставили в амплификатор на пару часов. В амплификаторе смесь то нагревалась, то остужалась и на выходе мы получили пробирку в которой плавает очень много копий ДНК нужного нам гена.

    Однако пробирка прозрачная, как увидеть что там есть какая-то ДНК, да еще нужная?

    image

    Детекция ДНК.

    Существует много способов увидеть ДНК, я же опишу классический, называемый гель-электрофорезом.

    В лаборатории имеется небольшая ванночка с электродами, называямая форезной камерой.
    В эту ванночку заливается расплав электрофорезного геля, который по сути очень похож на мармелад. Но вместо сахара там находятся добавки солей и флуоресцентный краситель – бромистый этидий. Это вещество интересно тем, что встраивается в молекулу ДНК и в этом случае начинает светиться в ультрафиолете.

    После того как гель застынет мы наносим в лунку на нем препарат ДНК где предположительно уже должно быть много копий гена bl1 и включаем электрический ток. В другую лунку наносим “маркер веса” – специальный препарат молекул ДНК, состоящий в равных долях из молекул длины 100, 200, 300 и т.д. нуклеотидов.
    Молекулы ДНК полярны и движутся в электрическом поле, при этом чем они длиннее, тем сильнее цепляются за структуру геля и тем медленнее в нем движутся. Через некоторое время мы выключаем электричество и несем гель под ультрафиолетовую лампу.
    На той дорожке где мы нанесли маркер веса мы видим кучу полосок. Самая дальняя от места нанесения пробы соответствует самой короткой ДНК, самая ближняя – самой длинной.
    В соседних лунках ДНК бежит с одинаковой скоростью, поэтому мы сравниваем их расположение на соседних дорожках и можем определить, относительный размер.

    Итак, мы обнаружили на дорожке где нанесли пробу одну светящуюся полоску и размер ее судя по соседнему маркеру веса является таким, каким мы ожидали.

    image

    Мы аккуратнентко вырезаем лезвием из геля этот светящийся кусочек – он содержит много ДНК гена bl1 запутавшейся в геле и с помощью специальных манипуляций высвобождаем из него молекулы.

    Можно себя поздравить, мы выделили ген bl1 из бутявки!

    Я рассказал только о первой стадии этого сложного и длинного процесса. Продолжать ли дальше? Решать вам :)

    upd. Часть вторая.
    Часть третья.
    upd2. Перенес в биотехнологии
    Share post

    Comments 156

      +12
      Спасибо, вы взорвали мне мозг. ©

      особенно этим:

      ATGAGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATG
      GGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTAT
      TTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGGTTATGGTGTTCAATGC
      TTTGCGAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCTGAAGGTTATGTAC
      AGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGA
      TACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAA
      TTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGAATCAAAGTTA
      ACTTCAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCC
      AATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGAT
      CCCAACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATGGCATGG
      ATGAACTATACAAATAA
        +1
        Черт, я был уверен, что занес это в черновики :( Что ж, пусть будет так.
          0
          «купнули туда чуть-чуть ДНК»
          может таки «капнули»? -_0
          +21
          В этом месте я плакал
          ACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCTGAAGGTTATGTAC
          AGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGA
          TACCCTTGTTAATAGAATCGAGT
            –13
            кто писал этот говнокод?
            … что значит мать-природа не познала ООП?!!!
              +3
              это почти машинный код. =) только тут не нолики и единички. а немного сложнее =))
                0
                Ну это так записанно просто, машинный код тоже для удобства в шестнадцатеричной системе счисления представляют иногда, а тут предтсавленно в системе с основанием 4.
              0
              я представляю, ЧТО начнется, когда появятся первые ДНК-фреймворки =)
                –1
                Юзер M$ Clone 2048: «Еб твою мать! Почему ты не компилишься?»
                Жена юзера: «Угу, 10 лет как последний раз еб...»
              –3
              Да, у меня тоже кажись мозг сломалсяяяяяяяяяяя…
                +2
                А у меня не сломался, с удовольствием прочту продолжение. Обязательно в этой статье укажите про продолжение :)
                  0
                  Недавно начал читать, но непошло… буду пробовать еще раз.

                  bookz.ru/authors/nikolai-dagterev/gennaa-i_857.html
                0
                последовательность нуклеотидов, кажется еще в школе проходят. :)
                  +1
                  Одно дело проходить, а другое дело, когда понимаешь, что люди реально с этими простынями букв работают :)
                  Для облегчения чтения этого всякие программы, кстати есть полезные (можно размечать области, искать участки гомологии, отделять структурные элементы друг от друга). Но все равно код первичен.
                    0
                    Безусловно Вы правы. Кстати видел на одной из кафедр медуниверситета iMac с какимто ультранавороченным (и дорогим, ~10k если не врали) софтом именно для этого. Правда не понял и половины из того что объяснял мне человек, с ним работающий…
                    А статья интересная, да. Завтра покажу другу — кандидату, как раз молодому светилу от генетики, предвкушаю интересную беседу.
                  +2
                  Хе-хе, не удивительно. Код похож BrainF*ck :)
                    0
                    И компилируется через схожее действие, только без участия моска:)
                      0
                      Не силен в генной инженерии, но уверен, что компиляция несколько иным образом происходит :)
                        0
                        Еще бы, там вовсе ничего не компилируется, ибо все это по сути коды самой системы, речи о языках высокого уровня пока просто нет ;)
                          0
                          Какой простор для творчества… Microsoft Dna Studio 2021?
                    –2
                    Хабракат?
                    +9
                    очень круто, жду продолжения.
                      +4
                      Прочел один раз… надо будет перечитать еще раз или два минимум. Но на самом деле оч. даже интересно, хоть и странно видеть подобный материал на IT-ресурсе.
                        +26
                        Я сейчас начинаю работать на стыке IT и биотехнологий, тренируюсь нести слово науки среди программистов :)
                          +2
                          Успехов вам)
                            +1
                            Очень хорошим, доступным и простым языком объясняете, продолжайте в том же духе! Бутявка особенно порадовала))
                          +10
                          Еще!
                            +3
                            интересно. продолжайте. :)
                              +2
                              хоть и не увлекаюсь этим, но прочитал с удовольствием (сессия, не к экзаменам же готовиться;)
                              жду следующих статей.
                              надеюсь и по IT тематике тоже будут:)
                              спасибо
                                +3
                                А чем вам не IT? там биты, тут гены, собственно генетики тоже программы пишут только язык программирования у них тяжелее наших :) всего 4 команды и чтобы их ввести надо еще постараться.
                                +3
                                говорят, что математики имеют склонности к музыке.
                                айтишники, выходит, к биологии?
                                и знаете что… мне это действительно интересно! =)
                                  +9
                                  Сама работа ДНК и наследственного аппарата очень интересна с точки зрения информатики, может быть об этом тоже как-нибудь напишу. Это же редкий пример когда программа только и делает, что исполняет сама себя разными способами :)
                                    –1
                                    Программисты и юристы очень часто близки по мышлению.
                                      0
                                      Не согласен.
                                      Жена юрист…
                                        0
                                        Не каждый юрист является программистом в уме (что, впрочем, часто свидетельствует и о качестве юридической стороны мышления), однако практически каждый программист может освоить юриспруденцию. Disclaimer: я сам по образованию юрист и жена у меня юрист (но ни фига не дружит с компьютерами и с головой :).
                                          0
                                          Курс правоведения в университете у нас вел юрист, специализирующаяся в области телекоммуникаций, и она нам сама рассказала, что ей понять технические особенности сотовых сетей очень сложно, а нам, радиотехникам, изучить юриспруденцию в разы легче. Видимо сильно влияет практичный, инженерный подход к вещам.
                                          ЗЫ Да, и мне ещё со школы интересная и химия и генетика, особенно как работают ретро-вирусы :)
                                        0
                                        Опыт учебы на юрфаке мне подсказывает, что все-таки не очень. :)
                                          0
                                          Скорее, врачи и юристы.

                                          И тем, и другим нужно дедуктивное мышление (из общих законов выводим действия в данной конкретной ситуации).

                                          А в науке нужно мышление индуктивное (от фактов к теории).
                                            0
                                            Нужно и то и другое :)
                                          0
                                          я в десятом классе второе место на окружной олимпиаде по биологии занял)
                                          при том, что первого не было — никто не занял
                                          0
                                          Спасибо, ждемс продолжения!
                                            +5
                                            из пожеланий что хотелось бы еще узнать о генных манипуляциях для людей непосвященных:
                                            — вредны ли генно-модифицированные продукты и существует ли способ определить вредность…
                                            — если стал известен ген (у человека) который отвечает за интересующую нас функцию (например Рост), есть ли и какие способы подавлять/способствовать влиянию этого гена на человека (в текущей жизни, а не у потомков в последующих поколениях)
                                            — так сказать «на пальцах» про стволовые клетки и что это и как они становятся нужными видами клеток/органами
                                              +2
                                              ПРО ГМО действительно интересно!!! С удовольствием бы почитал!
                                                0
                                                ГМО — Генетически модифицированные организмы, если кто не понял :)
                                                  0
                                                  Вот спасибо! А то читаю на банке фасоли: «не содержит ГМО», и последняя буква всегда оставалась загадкой. А теперь ясно — банка фасоли ГМ-организмов не содержит. Но немодифицированных-то не отрицается! >>8-|
                                                    0
                                                    а ПРО — противоракетная оборона? :)
                                                      0
                                                      Лучшая аббревиатура, оканчивающаяся на О — СПО.
                                                    +5
                                                    +4
                                                    1. В общем смысле не вредны, но тема интересна всякими неочевидными аспектами поведения трансгенных организмов в биоценозах. Я подумаю, можно ли это будет изложить популярно.

                                                    2. Ага, понял. Хорошая тема и очень сложная, кстати. Не факт, что я смогу по ней хорошо объяснить, подумаю над этим.

                                                    3. Еще одна сложная тема. Расскажу про генные каскады :) Самая «программистская» из всех, кстати.
                                                      +1
                                                      Про ГМП конечно интересный вопрос, но мне кажется что ответ на него почти очевиден, если подумать, чем отличается для нашего желудка обычные клетки от г.м.
                                                        +2
                                                        Они вредны только с экономической точки зрения, т.к. производство конечного продукта дешевле в итоге.

                                                        Именно поэтому раздувается мегапиар на тему, что это вредно и ставятся всякие маркеры типа «нет ГМО».

                                                        Если встать на точку зрения сторонников запрета ГМО, то можно прийти к экстремуму, что вредно всё антропогенное и мы должны жить в пещерах, как в каменном веке.
                                                          +1
                                                          С экономической точки зрения ГМП как раз полезнее, т.к. как иначе прокормить всё растущее население земли?
                                                            0
                                                            С экономической точки зрения все, что снижает себестоимость конечного продукта, полезно. А конечная цена — зависит от платежеспособного спроса. Т. е. чтобы у потребителей (широких масс, если мы говорим о с-х) было чем заплатить за все разнообразие продуктов. А чем сегодня платит потребитель — прежде всего квалифицированной рабочей силой (неквалифицированная фактически дотируется государством и прямой прибыли не приносит), плодами интеллектуального труда. Для чего необходимы не только хлеб и вода, но и…

                                                            Байки о вреде ГМО распространяют производители, позиционирующие себя как «экологичные». Для особо озабоченных потребителей. Обычная война старого и нового (извозчики против машин), в которой всегда рано или поздно побеждает новое.
                                                            +1
                                                            — к генно-модифицированному растению нужно относится как к абсолютно новому виду. Исследовать его съедобность /несъедобность, полезность/вредность. И вредность, если она будет, будет относится только к этому растению, а не генно-модифицированным растениям в целом. Существуют необоснованные опасения что чужие гены встроенные в растение априори опасны, ядовиты, могут проникать в человека при поедании растения. При поедании абсолютно все равно съели вы муху с помидором, или съели помидор с генами мухи. В обоих случаях в желудок попадают одинаковые гены и одинаково разлагаются. Вероятно, что и белки попадут одинаковые. Но существует вероятность, что ген мухи в помидоре будет вести себя по другому, чем в самой мухе (эффект положения). Поэтому мухопомидор нужно рассматривать как новое растение, похожее на помидор с мухами :). Абсолютно нормальный мутант :)

                                                            — В некоторых случаях можно выключать и включать гены. Но тут лучше специалисты объяснят про регуляцию да экспрессию. Но тема эта сложная. Еще можно сделать вирус который встраивается в ДНК и кодирует гормон роста или производство морфин. Правда такое грубое вторжение ни к чему хорошему не приведет. И думаю, что, например, превратить человека в муху нереально — слишком большие изменения в физиологии и организм не выживет, если даже такой процесс получится запустить.
                                                              0
                                                              Вообщето я имел ввиду подавление генов не с целью превратить человека в муху, а в целях лечения генных заболеваний или отклоненений, или в идеальном случае — увеличения срока человеческой жизни (где-то читал что возраст отмеренный человеку зашит в каком-то гене)…
                                                              Но в целом, ход ваших мыслей мне понравился ;-)
                                                          +5
                                                          мегакруто, требуем продолжения
                                                            0
                                                            С удовольствием почитал бы таких статей еще.
                                                              –2
                                                              в общеобразовательных целях полезно, вдруг в кроссфорде будет
                                                                0
                                                                Спасибо!
                                                                  0
                                                                  Здорово! Спасибо!
                                                                    0
                                                                    Ждем не дождемся нанороботов.

                                                                    Уже что-то подобное замутили здесь: lenta.ru/news/2009/01/06/walking/

                                                                    Как я понимаю, он шагает с помощью ДНК по белку, но ведь еще не вечер? :)

                                                                    Прокомментите пожалуста.
                                                                      +2
                                                                      Принцип транспорта который описан по ссылке не позволяет путешествовать по любой молекуле ДНК и слишком неточен. Белки (о них речь идет в начале) работают гораздо лучше, на порядки.
                                                                      Поэтому это пока представляет только академический интерес.
                                                                      0
                                                                      Статья понравилась, только интересно, как все-гаки любители умудряются заниматься этим в домашних условиях? Ведб наверняка требуется недешевое оборудование, препараты, которые не так просто достать простому человеку. Или на западе уже продаются какие-нибудь наборы юного генетика?
                                                                        +4
                                                                        Забыл указать цены на приборы и реактивы. Вообще-то из совершенно необходимых вещей тут амплификатор, центрифуга для переосаждения ДНК и камера для фореза, этот комплект потянет тысячи на две долларов (если брать старые модели б/у), но умельцы это могут сделать на коленке (пожалуй, кроме центрифуги).
                                                                        +2
                                                                        Я уже где-то читал про выделение нужного гена, только там было слишком много слов, которых я не понял. В этот раз было очень увлекательно. Спасибо. С нетерпением жду продолжения.
                                                                        Очень интересно как эту полоску внедрить в елку :)
                                                                          +1
                                                                          после слова «молекула» пришел тихий ужас =) не силён я в био… ну разве что луковицу ийодом поливать =)
                                                                            0
                                                                            Прочитал с огромным удовольствием, жду продолжения :)
                                                                              0
                                                                              Очень интересно.
                                                                              По возможности продолжайте.

                                                                              PS У djvu в посте 7 января 2009, 22:55 достаточно интересные вопросы (особенно второй), но воможно для начала стоит закончить с начатой темой.

                                                                              Спасибо!
                                                                                +1
                                                                                Достаточно адекватно на понятном языке. Спасибо!

                                                                                Пара замечаний:
                                                                                1. В каждой моей клетке обычно 46 или 92 линейные молекулы ДНК (хромосомы) и до нескольких сот кольцевых (митохондриальная ДНК).
                                                                                2. При описании реакции «писуар» лучше указать, что праймеры одноцепочечные и что синтез идёт только в одном направлении.
                                                                                  +3
                                                                                  1. Безусловно, апдейтну пост. Просто для целей генной инженерии обычно мы оперируем количеством молекул, несущих компию гена, а их именно две и я не акцентировал внимание на других хромосомах.

                                                                                  2. Там одно за другое потянет, мне кажется это бы вышло за рамки такой краткой статьи. Если кто подробно интересуется, лучше в википеди почитать, там хорошо описано.
                                                                                    0
                                                                                    Значит статьям из русской википедии на тему генетики можно доверять?
                                                                                      +1
                                                                                      Ляпов там очень мало, статьи хорошие.
                                                                                  0
                                                                                  Весьма занимательно.
                                                                                    +1
                                                                                    Очень живо написано, действительно стало понятней.
                                                                                      +1
                                                                                      Здорово! Хочу ещё.
                                                                                        +3
                                                                                        Ничего не понял, но очень интересно =)
                                                                                          0
                                                                                          Супер! Жду продолжения
                                                                                            +1
                                                                                            Хочу к Вам!!! =)
                                                                                              0
                                                                                              Более алгоритмизированно это описано здесь www.keldysh.ru/papers/2005/prep57/prep2005_57.html
                                                                                              Интересно.
                                                                                                +1
                                                                                                Очень интересно, спасибо.
                                                                                                  +1
                                                                                                  Спасибо за очень интересную статью!

                                                                                                  П.С. А еще меня ужасно смешили игры вида «Вставил ген краба — получил клешню вместо руки». Теперь они будут смешить меня еще громче :)
                                                                                                    +4
                                                                                                    Да, это самая главная ошибка тех, кто этим не занимается. На самом же деле манипуляция с генами происходит на гораздо более элементарном уровне и до клешни вместо руки там еще очень, очень далеко.
                                                                                                    Мы умеем манипулировать теми признаками, которые могут быть изменены работой максимум нескольких генов, но не десятков и сотен.
                                                                                                    И еще, намного проще разрушить какую-то функцию (как говорят биологи, нокаутировать ген), чем создать какую-то новую.
                                                                                                      0
                                                                                                      >И еще, намного проще разрушить какую-то функцию (как говорят биологи, нокаутировать ген), чем создать какую-то новую.
                                                                                                      Сразу же приходят в голову ассоциации вида: человечество на данном этапе как неандерталец с дубиной, ворвавшийся в информационный центр, забитый серверами. В состоянии порубать, сжечь и раскромсать что угодно, а вот разобраться (иуж тем более повторить) — силы не те. :(
                                                                                                  0
                                                                                                  Офигенно! Продолжайте!
                                                                                                    +9
                                                                                                    Я бы даже сказал, офигенно :-)
                                                                                                    +1
                                                                                                    Ребят, ниче не понял, честно. Но жутко заинтерисовало (с раннего детства люблю биологию). Пишите еще!
                                                                                                    • UFO just landed and posted this here
                                                                                                        +6
                                                                                                        Вирус можно собрать икусственно, причем вообще, полностью с нуля. Если приводить аналогию с программами, то клетка — это полноценная ОС. Даже самая простая ОС все равно крайне сложна биологически, поэтому до сих пор живой клетки не синтезировали, хотя есть целый проект на эту тему.

                                                                                                        Вирус же представляет собой простую программу заточенную под конкретную ОС и содержит совсем мало команд.
                                                                                                          +3
                                                                                                          Вот так «на пальца» программистам и надо объяснять биологию. Все образно и понятно :)
                                                                                                            0
                                                                                                            У меня есть некие мысли в голове насчет того, как можно объяснить машинерию ДНК в клетке программистскими терминами с биологической точки зрения, но я немного подожду когда они как следует сформируются. Аналогия с ОС слишком груба чтобы ее применять где-нибудь, кроме такого вот примера.
                                                                                                              0
                                                                                                              Я немного поздно ), а литературу по данной теме не посоветуете?
                                                                                                        0
                                                                                                        спасибо
                                                                                                        узнал много нового
                                                                                                        жду продолжения! (8
                                                                                                          –4
                                                                                                          А может все таки не надо так — о сложных вещах, да на коленке?

                                                                                                          Мы ведь с вами каждый день сталкиваемся с последствиями популяризации компьютеров (ламеры), программирования (быдлокодеры), интернета (контингент Одноклассников и ВКонтакте).

                                                                                                          Сейчас вы популяризируете генетику. Конструкторы уже в продаже. Интересующихся вопросом (в ключе, «а чё, пацаны, реально можно шота замутить?») — полно.

                                                                                                          Мне страшно! :)
                                                                                                            +3
                                                                                                            Надо. Это позволяет быть разносторонним человеком. Тягу к знаниям лично я считаю это просто базовой ценностью, ну т.е. это хорошо просто потому что это хорошо :)

                                                                                                            Ведь все равно чтобы реально все это проделывать на практике, придется учиться минимум 2-3 года как теоретически, так и практически. Здесь очень много подводных камней.

                                                                                                            Зато люди будут представлять как процесс происходит с точки зрения тех, кто реально с ним работает, а не с точки зрения журналистов, прости господи :)
                                                                                                              0
                                                                                                              Вспомнились недавние очень неприятные споры на экономические темы, с «разносторонними» людьми, которым «на пальцах» «объяснили» экономику. )
                                                                                                                +6
                                                                                                                Каждый человек должен знать границы своего уровня компетентности и спорить только внутри него. Спорить снаружи него — бессмысленно, лучше уж книжку по теме почитать. В то же время это не должно мешать интересоваться чем-то и за пределами этого круга, просто не нужно думать, что ты во всех темах являешься специалистом, которому есть что сказать.
                                                                                                                  +2
                                                                                                                  Хм… Очень разумные слова, вы меня убедили. :)
                                                                                                            0
                                                                                                            Спасибо, отличная статья! Вы прямо разожгли во мне интерес! С нетерпением жду продолжения.
                                                                                                              0
                                                                                                              охренительно!
                                                                                                                +3
                                                                                                                Немного не понимаю как работает этот фрагмент — GTATTGATTTTAAAGAA
                                                                                                                  +1
                                                                                                                  Дык всё элементарно:
                                                                                                                  * GTA: «Grand Theft Auto» — Grand theft Auto
                                                                                                                  * TT: Можно трактовать двояко: то ли это тульский Токарев, то ли Audi TT. Неоднозначно как-то…
                                                                                                                  * GAT: если посчитать, что gat — пистолет на американском сленге, то TT (предыдущий пункт)— всё так и Токарев
                                                                                                                  * TTT — процесс срельбы из этого самого Токарева
                                                                                                                  * AAA — вопли раненного
                                                                                                                  * GAA — радость стрелявшего.

                                                                                                                  Судя по всему, описание какого-то квеста из GTA.
                                                                                                                    0
                                                                                                                    Спасибо большое, я почему-то не подумал о том что GAT — это пистолет. Тогда все очень даже понятно :)
                                                                                                                      0
                                                                                                                      так говорит Лингва:
                                                                                                                      gat
                                                                                                                      I archaic a past tense of get
                                                                                                                      II slang chiefly a pistol or revolver Etymology: shortened from GATLING GUN
                                                                                                                  0
                                                                                                                  спасибо! очень интересно! прочёл на одном дыхании!
                                                                                                                    0
                                                                                                                    Судя по всему, скоро мы будем читать третьей парой глаз на одном дыхании спинного легкого :)
                                                                                                                    Благодарность автору сей статьи — читать было очень интересно.
                                                                                                                    • UFO just landed and posted this here
                                                                                                                        0
                                                                                                                        В точку :)
                                                                                                                          0
                                                                                                                          Да ладно вам, шутка юмора понимаешь :)
                                                                                                                      0
                                                                                                                      О!!! Вот ради таких статей и читаю Хабр! Жду продолжения!
                                                                                                                        0
                                                                                                                        Огромное спасибо! Статья супер. Обязательно, продолжайте.

                                                                                                                        Если можно вопрос. В школе, к сожалению, всего этого не учил, навёрстываю сейчас.

                                                                                                                        Если правильно понял в одной молекуле ДНК может содержаться несколько генов. В каждой клетке бутявки находится две ДНК и в каждой из них множество генов. То есть, выделить ДНК гена bl1 означает, что мы воссоздаём какой-то определённый фрагмент ДНК бутявки, верно?
                                                                                                                          0
                                                                                                                          Да.
                                                                                                                            0
                                                                                                                            Именно так. Определенный фрагмент мы очень много раз копируем и получаем, что остается почти только он.
                                                                                                                            0
                                                                                                                            самый главный вопрос — можно ли все это реализовать в домашних условиях? то есть при наличии «паяльника и прямых рук» (можем собрать любую печку/холодильник программируемый) и обычного микроскопа из магазина (ну пусть за 30 тыр)
                                                                                                                              0
                                                                                                                              Даже паяльник не понадобится — большинство приборов уже вполне доступно по ценам для простых смертных.
                                                                                                                              +2
                                                                                                                              Может отдельный блог создать? Кармы уже хватает.
                                                                                                                                0
                                                                                                                                Пожалуй так и сделаю.
                                                                                                                                  0
                                                                                                                                  Предлагаю название «Биотехнологии».
                                                                                                                              0
                                                                                                                              хорошая статья — достаточно неплохо и интересно написано, чего не скажешь о многих последних пуликациях на хабре. с удовольствием прочитаю продолжение.
                                                                                                                                +1
                                                                                                                                ещё, просто интересно, а где вы работаете? :)
                                                                                                                                  0
                                                                                                                                  6 лет работал в биологическом НИИ в лаборатории генной и клеточной инженерии, параллельно получая высшее образование. Сейчас на распутье :)
                                                                                                                                  0
                                                                                                                                  Спасибо за ликбез!!! ждем продолжения :)
                                                                                                                                    0
                                                                                                                                    Прочитал на одном дыхании! Мегареспект и квадроуважуха от меня. В частности за стиль изложения ;-)

                                                                                                                                    Кое-что не понял в силу своего ума, а кое-что — будто бы из-за того что оно мало освещено. Вот примеры.

                                                                                                                                    /* Мы выбиваем из шефа командировку на побережье Мальдивских островов, где только и водится пресловутая бутявка морская (Butiavka marina). */

                                                                                                                                    А откуда известно что она подходит для выделения гена? Ладно если она светится, но если её свойства не такие видимые?

                                                                                                                                    /* Ловим ее, толчем в порошок, заливаем последовательно разными химическими гадостями чтобы из всей массы тканей в растворе остались только молекулы ДНК. */

                                                                                                                                    Мне непонятно как это (принципиально) работает. Чем характерны эти гадости, что только ДНК и оставляют? :-о
                                                                                                                                      0
                                                                                                                                      Ага… с бутявки вроде как всё и начиналось. Если так, первый вопрос закрыт.
                                                                                                                                        0
                                                                                                                                        Один из основных методов выделения ДНК основан на обработке экстрактов клеток раствором додецилсульфатом натрия (ДСН, SDS) — молекулы ДСН имеют длинный гидрофобный хвост, который проникает вглубь белков, а гидрофильная головка способствует растворению получающегося комплекса и освобождению ДНК от упаковывающих её белков. С ДНК ДСН не взаимодействует, поэтому ДНК остаётся в растворе. После очистки раствора от деградированных белков (центрифугированием) ДНК высаждается из раствора ледяным спиртом (этиловым или изопропиловым).
                                                                                                                                          +1
                                                                                                                                          Про бутявку мы узнаем обычно из чужих статей.

                                                                                                                                          Выделение ДНК происходит по следующим реакциям:

                                                                                                                                          1. Сначала добавляется детергент+ литический агент (чтобы клетки разрушить), либо просто детергент. Молекулы клетки в этом случае разбиваются из своих комплексов и переходят в раствор. В качестве литического раствора может применяться обычная щелочь.

                                                                                                                                          2. центрифугирование и удаление нерастворимых фракций.

                                                                                                                                          3. Добавляют фенол/хлороформ для того, чтобы белки выпали в осадок.

                                                                                                                                          4. Центрифугирование и удаление выпавших в осадок белков.

                                                                                                                                          5. Дополнительная очистка, если нужно.

                                                                                                                                          6. Добавление этилового или изопропилового спирта, выпадение ДНК в осадок. Сливаем надосадочную жидкость и поучаем препарат.

                                                                                                                                          А подробно протоколы есть тут: molbiol.ru/protocol/
                                                                                                                                          0
                                                                                                                                          Интересно.
                                                                                                                                          Скажите, а есть разница между
                                                                                                                                          ATGAGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATT и
                                                                                                                                          ATGAGTAAGGGGGAGGAGCTTTTTACGGGGGTTGTTCCTATT?
                                                                                                                                          (Надеюсь я не ошибся при перекодировании:)
                                                                                                                                          Хотя еще более интересен механизм ограничения роста. Как яблоко знает что оно круглое, а огурец вытянутый. Где это хранится и как работает? Вот что занимает меня в биологии в последнее время. Может Вы знаете известен ли это механизм ученым, или у меня есть шанс прославится :)

                                                                                                                                            0
                                                                                                                                            Вы уже не первый задаете этот вопрос. Я расскажу о регуляции развития как только закончу с этой темой.

                                                                                                                                            Насчет разницы между последовательностями. Это зависит от того, что за последовательности и какую функцию несут. Геном имеет свойство вырожденности, наиболее сильно проявляющееся в той части ДНК, которая непосредственно кодирует белки. То есть один и тот же смысл можно записать разными буквами.
                                                                                                                                            Если вы имели ввиду вырожденность триплетного кода (т.е. при кодированиии белков), то где-то ошиблись, последовательности не совпадают ;)
                                                                                                                                              0
                                                                                                                                              Эх ошибся таки
                                                                                                                                              Ага. Именно это и имел. Интересно различается ли действие генов если они кодируют один и тот же белок, но разными последовательностями.

                                                                                                                                              Значит люди в белом выяснили механизм роста и формирования формы. Эх пропала моя нобелевская :(
                                                                                                                                                0
                                                                                                                                                >Интересно различается ли действие генов если они кодируют один и тот же белок, но разными последовательностями.

                                                                                                                                                Если последовательность белка в итоге получается та же самая то не различаются.
                                                                                                                                                Другое дело, что в гене есть не только кодирующая часть, но и некодирующие, несущие служебную информацию. Вот различия в тех частях могут повлиять на то, будет белок синтезироваться или нет, а если будет, то в каких случаях, несмотря на то, что это будет все тот же белок.
                                                                                                                                            +1
                                                                                                                                            Я буду давать наглядные и понятные обычным людям примеры для описания сложных процессов — Спасибо тебе суперЧеловек)
                                                                                                                                              –1
                                                                                                                                              Спасибо за статью, хотя не могу не отметить досадную ошибку.
                                                                                                                                              >>На каждой стадии наращивания эффективность составляет порядка 99%.
                                                                                                                                                –1
                                                                                                                                                Комментарий почему-то отправился

                                                                                                                                                Спасибо за статью, хотя не могу не отметить досадную ошибку.
                                                                                                                                                >>На каждой стадии наращивания эффективность составляет порядка 99%.
                                                                                                                                                >>представьте, что нам нужно сделать молекулу длиной в 1000 букв?
                                                                                                                                                >>Тогда применяя банальную арифметику окажется, что доля верных молекул составит 0,99^1000=0,00004

                                                                                                                                                Это не банальная арифметика, а теория вероятности, которая гласит, что предыдущие эксперименты не влияют на вероятности следующих.
                                                                                                                                                Проще говоря, если эффективность составляет 99% на каждой стадии экперимента, то из 1000 букв неверными будут 1%, а 99% будут верными, как и положено.

                                                                                                                                                Другое дело, если бы вы ставили вопрос: какая вероятность того, что все 1000 букв подряд будут верными — вот тогда она будет составлять 0,99^1000=0,00004
                                                                                                                                                  0
                                                                                                                                                  Именно такой вопрос и стоял, должны быть верны все буквы.
                                                                                                                                                    +1
                                                                                                                                                    О. Простите, неверно прочитал. Прочитал «доля неверных букв» вместо «доля неверных молекул».
                                                                                                                                                    У вас все правильно. Еще раз спасибо за статью.
                                                                                                                                                0
                                                                                                                                                Крайне интересно! Продолжайте.
                                                                                                                                                Можно было назвать цикл статей: «Генная инженерия — это просто!».))
                                                                                                                                                  0
                                                                                                                                                  Это будет слишком далеко от истины ;)
                                                                                                                                                  0
                                                                                                                                                  Сразу вспомнила родной универ и практику.
                                                                                                                                                  P.S. Кроме вырожденности генетического кода есть еще альтернативный сплайсинг и прочие радости жизни
                                                                                                                                                    0
                                                                                                                                                    мне вот интересно — будет ли в конце елка? =) так что продолжайте!
                                                                                                                                                      0
                                                                                                                                                      Хорошоя статья и понятная, что очень важно. Но хотелось уточнить, как происходит отсеивание ДНК от молекулы? Тоесть они ведь все на биологической основе и по-идее на саму ДНК эти химические вещества должны так-же действовать. Разрушается ли какая часть ДНК при этом «отсеивание»?
                                                                                                                                                      Это всё конечно мысле на основе более чем дилитанских знаний в этой области, так что просьба сильно не бить! :-)
                                                                                                                                                        0
                                                                                                                                                        Сама ДНК обычно в процессе манипуляций (отсеивание от белков и других молекул клетки) рвется на части длиной 10-100 тысяч пар оснований (ее начальная длина обычно миллионы и сотни миллионов), но это не мешает, так как процессы тут статистические и если уж какая-то молекула ДНК порвалась в области нашего гена, то в растворе всегда есть те, которые в этом месте остались целыми.
                                                                                                                                                        0
                                                                                                                                                        наткнулся на внятную картинку ДНК котрая связывает упомянутый выше код «ATGAGTAAAGGAG...» с привычной обывателю двойной спиралью с перемычками:
                                                                                                                                                        www.scq.ubc.ca/wp-content/dna.gif (через тег img картинка не отображается… :( )
                                                                                                                                                          –1
                                                                                                                                                          Здорово! Только вопрос к вам — вы начинаете оперировать понятием «ген» и не даете его примерного определения:) Отсюда же неясна связь гена с молекулами ДНК:)

                                                                                                                                                          За статью спасибо, с нетерпением жду продложения!
                                                                                                                                                            +1
                                                                                                                                                            Что ж, дам. Я руководствуюсь определением, что ген — это функциональный элемент ДНК, отвечающий за синтез определенной РНК.
                                                                                                                                                            0
                                                                                                                                                            вопрос — а разве ДНК в геле не разрушается связываясь с бромистым этидием?

                                                                                                                                                            И еще, вспомнил что есть игра по этому поводу: www.old-games.ru/game/1552.html
                                                                                                                                                              0
                                                                                                                                                              Нет, не разрушается. Этидий интеркалирует обратимо.
                                                                                                                                                              0
                                                                                                                                                              Пишите еще, весьма приятно такое почитать :) Еех, когда-то и я стажировался в молбиол-лаборатории… :) но жизненная дорожка пошла в несколько другом направлении…
                                                                                                                                                                0
                                                                                                                                                                Тут ребята по проблемам молекулярной биологии общаются www.molbiol.ru/
                                                                                                                                                                  0
                                                                                                                                                                  Там серьезное общение идет, с простыми вопросами пошлют в гугл ;)
                                                                                                                                                                    0
                                                                                                                                                                    Не согласен.
                                                                                                                                                                    Я думаю, что вопрос можно ли сделать молекулярную лабораторию из подручных средств у себя дома, вызовет бурное обсуждение.
                                                                                                                                                                  0
                                                                                                                                                                  Хорошая статья. Ждем продолжения!

                                                                                                                                                                  Не понял только про ПЦР. Есть молекула началом гена (20-30 букв), есть молекула с концом гена (20-30 букв). Как получается нужный кусок в сотню генов между началом и концом? Каким-то образом копируется с молекулы ДНК бутявки?
                                                                                                                                                                    0
                                                                                                                                                                    Википедия поможет отцу русской демократии :)

                                                                                                                                                                    Там всё в картинках, графиках, с литературой.
                                                                                                                                                                    0
                                                                                                                                                                    Потрясающе интересно и хорошо написано! Спасибо огромное.

                                                                                                                                                                    Пошёл после Вашей статьи читать в энциклопедии про ПЦР: "… основан на многократном избирательном копировании определённого участка ДНК при помощи ферментов..."

                                                                                                                                                                    А существует какое-то объяснение почему так происходит?
                                                                                                                                                                    Ну т.е., если я правильно понял, то, разбавив раствор праймерами и «стройматериалами», мы запускаем реакцию в результате которой праймеры достраиваются до полных генов, так?
                                                                                                                                                                    Есть какое-то объяснение или хотя бы детальное описание этого механизма достройки? Попытался найти сам, но в итоге понял что даже не знаю в какую сторону копать.
                                                                                                                                                                      0
                                                                                                                                                                      Вас интересует общая схема реакции или именно механизм присоединения нуклеотидов к растущей цепи днк?
                                                                                                                                                                      Если первое, то общая схема реакции есть в википедии.

                                                                                                                                                                      Если второе, то грубо говоря фермент — полимераза ползет по матричной цепи ДНК и строит около нее комплиментарную цепь. Если хотите найти подробнее, то ищите по слову taq polymerase (taq — это одна из полимераз использующаяся в ПЦР), но там уже будет заморочная химия.

                                                                                                                                                                      0
                                                                                                                                                                      Спасибо за хорошую статью!

                                                                                                                                                                      Only users with full accounts can post comments. Log in, please.